Wednesday, March 6, 2013

command line reverse complement sequence in linux shell

Sometimes it seems like BSD / GNU / Linux folks thought of everything.

echo AATGATACGGCGACCACCGG | rev | tr ATGC TACG

No comments:

Post a Comment